| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Original Research |
Center for Tropical Disease Research and Training, University of Notre Dame, Notre Dame, Indiana, and Clinical Research Center, Marshfield Medical Research Foundation, Marshfield, Wisconsin
University of Wisconsin-LaCrosse, LaCrosse, Wisconsin
Wisconsin Department of Health and Family Services, Madison, Wisconsin
Clinical Research Center, Marshfield Medical Research Foundation, Marshfield, Wisconsin
REPRINT REQUESTS: Jennifer Meece, PhD, Clinical Research Center, Marshfield Medical Research Foundation, 1000 North Oak Avenue, Marshfield, WI 54449, Telephone: 715-389-5142, Fax: 715-389-3808, Email: meece.jennifer{at}marshfieldclinic.org
Received: September 19, 2002.
Accepted: October 14, 2002.
[See related article: 5–12]
 |
Abstract |
|---|
 TOP Abstract INTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: Mosquito • West Nile virus • Surveillance
|
INTRODUCTION |
|---|
|
TOPAbstractINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
In 2000 and 2001 the virus expanded westward in the continental United States. By the end of 2001, the virus was identified as far west as the Mississippi River. As of October 8, 2002, the virus was identified in all states in the continental U.S. except Arizona, Utah, Nevada, Idaho and Oregon.6 Also, 2,768 laboratory confirmed human cases of WNV and 146 human mortalities have been reported as of October 8, 2002 by the Centers for Disease Control and Prevention (CDC).7
WNV is maintained in nature by cycles of transmission between birds and mosquitoes. A mosquito becomes infected after taking a blood meal from a vertebrate host that has a high level of circulating virus. It requires approximately 10–14 days for a mosquito to become infectious to another animal after receiving its initial infected blood meal. This time interval is known as the intrinsic incubation period. When a mosquito takes a blood meal containing the virus, the virus moves into the mosquito gut where it invades the midgut cells and moves across the midgut to invade other mosquito tissues. Eventually the salivary glands of the mosquito are invaded. When a mosquito takes a blood meal, the mosquito injects a small amount of saliva and virus into the host. The amount of time for a bird to attain a viremia sufficient to infect another uninfected mosquito varies from species to species. However, species such as crows become infectious within 3–5 days and experience high mortality from the infection. In order for a mosquito to actively transmit WNV from host to host, it must survive the intrinsic incubation period to take another blood meal.8
Historical data suggest that more than 50 species of mosquitoes may be present in Wisconsin.9 Breeding habitats, life histories and feeding habits vary significantly from species to species. Therefore, characterizing the types of mosquitoes present in endemic areas can be important in determining and implementing appropriate public health policies. For example, Culex spp. mosquitoes are known to be primarily ornithophilic (bird loving) in their feeding preferences. Because WNV is primarily transmitted between mosquitoes and birds, the majority of mosquito isolates have been from Culex spp. mosquitoes.10–13 The risk to humans and to other mammals from Culex spp. is less than the risk for birds. However, other mosquitoes, such as Aedes vexans are known to be opportunistic feeders. These mosquitoes will take a blood meal from a wide variety of hosts. These "bridge vectors" pose a more serious risk to human and other mammals.12 The third category of feeding preferences is known as mammalophilic (mammal loving). Examples of this type of mosquito are Ochlerotatus canadensis, Ochlerotatus triseriatus, and Ochlerotatus trivittatus.12
The CDC has published guidelines for monitoring WNV and other arboviruses in the U.S. The goal of these comprehensive surveillance programs is to identify WNV activity in birds, mosquitoes and horses as sentinels for potential outbreaks in humans. Important goals of mosquito surveillance are to identify potential mosquito vectors in a particular area, monitoring population densities of those vectors and determining infection rates.14
In 2001, the first WNV-positive birds were identified in five southeastern Wisconsin counties (Dane, Waukesha, Kenosha, Racine and Milwaukee). As a result of WNV introduction into the state, a response plan was organized for the anticipated further spread of WNV across Wisconsin. Prior to 2002, mosquito surveillance in Wisconsin was limited to a few counties or communities that chose to perform surveillance themselves, or to contract with private companies for surveillance and control. In June 2002 a pilot surveillance program in Wisconsin was initiated by a statewide task force under the direction of the Department of Health and Family Services to characterize mosquito species present in the WNV endemic area. The goals of the study included identifying and assessing relative abundance of the various mosquito species, and to test pooled samples for the presence of WNV. This article summarizes the results of mosquito surveillance and virus testing for the period June 1 to October 1, 2002.
|
METHODS |
|---|
|
TOPAbstractINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
An ABC carbon dioxide-baited light trap (Clarke Mosquito Control, Chicago, IL) was set out one night a week, at each site. The traps work by attracting female mosquitoes questing for a blood meal. Questing female mosquitoes are attracted to the carbon dioxide and heat emitted by the trap. Mosquitoes attracted to the traps are drawn into a collection bag by a small battery operated fan.
Six gravid traps (John W. Hock Company, Gainesville, FL) were also used on a rotating basis at sites in Racine, Kenosha, Milwaukee and Dane counties. Waukesha County elected not to use this type of trap. The traps work by attracting gravid females who are seeking oviposition sites. The traps are baited with a foul-smelling, organically enriched liquid. Many mosquitoes, particularly Culex spp., seek stagnant water for laying eggs. Although the number of mosquitoes collected in a gravid trap tends to be much smaller than in a light trap, the likelihood of obtaining a virus-positive mosquito is higher. Gravid females seeking an oviposition site have already taken a potentially infectious blood meal.
Each trap was set between 2:00 p.m. and 5:00 p.m., and collected the following morning. The mosquitoes were transported back to the laboratory where they were freeze-killed and stored at –80°C. The mosquitoes were packaged in 50 mL vials and transported on dry ice to the Marshfield Medical Research Foundation for identification and testing.
In addition to the routine trap sites, collections of mosquitoes were obtained from two sites (Milwaukee County and Adams County) that were known to have WNV activity based on the presence of WNV-positive dead birds or from human cases. At these sites two additional collection methods were utilized in an effort to conduct intensive on-site collections. These methods included a large hand-held aspirator that collects mosquitoes resting in brush, grass and vegetation, and a smaller hand-held aspirator used to collect mosquitoes in confined spaces such as storm sewers, viaducts and buildings.
Each mosquito was identified to species level using standard morphologic criteria.9,15 Like species from each site were pooled in groups that may consist of a minimum of 1 to a maximum of 50 mosquitoes. In some instances mosquitoes were fragmented and abraded, and could not be accurately identified. When this occurred, mosquitoes from these sites were pooled and classified as unidentified. Chill tables were used to maintain a cold chain throughout identification and processing.
Pools were homogenized in a cell culture media (DMEM supplemented with 10% fetal bovine serum and antibiotic/anti-fungicide) in1-dram vials containing glass beads and tested for virus by plaque assay. Plaque assays were performed using Vero cells (American Type Cell Culture, Manassas, VA) in 6-well plates. Plates were inoculated with the mosquito homogenate and virus allowed to adsorb to the monolayer for one hour. The homogenate was then removed and a media/gum tragacanth overlay was applied. Culture plates were incubated at 37°C for 5 days. The media was then aspirated off the monolayer, the plate stained with a formaldehyde/crystal violet stain and examined for the presence of plaques. Positive plaque assays were confirmed by reverse transcription polymerase chain reaction (RT-PCR).
For RT-PCR, RNA was extracted using a Qiagen RNeasy mini kit (Qiagen, Valencia, CA). A 15 µL RT-PCR reaction using the Roche Light Cycler RT-PCR kit (Roche Molecular Biochemicals, Indianapolis, IN) was performed under the following conditions: 0.125 µM forward primer (WNV F34 5'CCACCGGAAGTTGAGTAGACG 3'); 0.5 µM reverse primer (WNV R96 5'TTTGGTCACCCAGTCCTCCT 3'); 0.09 µM FAM/TAMRA labeled probe (WNV 56 5'TGCTGCCTGCGGCTCAACCC 3'); 5 mM MgCl2; 4.0 µL RT-PCR reagent vial 2; 0.5 U uracil nucleotide glycosylase; and 0.4 µL RT enzyme. PCR cycling parameters were as follows: 1 cycle at 50°C for 60 seconds; 1 cycle at 55°C for 1,500 seconds; 1 cycle at 95°C for 240 seconds; 40 cycles of 95°C for 0 seconds followed by 60°C for 20 seconds; and 1 cycle at 40°C for 30 seconds.16 Positive and negative controls were included in each run. Positive controls were RNA obtained from the Wisconsin State Laboratory of Hygiene. Negative controls consisted of master mix minus RNA template.
|
RESULTS |
|---|
|
TOPAbstractINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
. In total 31,419 mosquitoes were collected between the first week of June and October 1, 2002. These were divided into 1,592 pools. The first four weeks of surveillance do not contain data from Waukesha County. Dane County discontinued the surveillance effort following week 12. As a result, weeks 13 – 17 do not contain data from Dane County.
|
). The six most abundant mosquito species collected were Aedes vexans, Ochlerotatus trivittatus, Culex tarsalis, Coquillettidia perturbans, Culex pipiens/restuans, and Ochlerotatus canadensis. During the 5 weeks with the highest counts (weeks 4, 5, 6, 7 and 13) two species, Aedes vexans and Ochlerotatus trivittatus, together accounted for 92.5%, 81.4%, 78.2%, 60.5% and 89.9%, of the total weekly count, respectively. The six most abundant species are known to be highly competent vectors of WNV and other arboviruses. In addition, 17 of the 25 total mosquito species found in southeastern Wisconsin have been shown to carry WNV in other parts of the U.S.
|
|
DISCUSSION |
|---|
|
TOPAbstractINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
The most common intervention taken for the prevention of arboviral infections is vector control, i.e., larviciding mosquito breeding sites or spraying for adult mosquitoes in densely populated areas. Determining whether or not to initiate vector control is a complicated process because numerous ecological and other variables affect mosquito populations. Also the risks of pesticide use balanced against the risk to humans must also be considered.17 In Wisconsin there is limited baseline data on the distribution of most mosquito species and their population densities. A single year of surveillance data is generally insufficient to make such determinations.
As more is learned about the role of various mosquito species in the transmission of diseases such as WNV, it becomes apparent that disease transmission cycles are complex and multifactoral. Future research will include continued surveillance of mosquitoes, tracking virus movement with the aid of viral sequence data, and identifying bird species involved in the spread of such diseases. All parts of the world face the ongoing threat of continued introduction of diseases previously unknown to their area. Mosquitoes, ticks and other disease vectors transmit many of these emerging and infectious diseases. An understanding of the ecology and distribution of these vectors will continue to play an important role in understanding the spread of human and veterinary diseases.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPAbstractINTRODUCTIONMETHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Madden West Nile Virus Infection and its Neurological Manifestations Clin. Med. Res., April 1, 2003; 1(2): 145 - 150. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
